Review



mouse miltenyi biotec  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Miltenyi Biotec mouse miltenyi biotec
    Mouse Miltenyi Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 98/100, based on 2227 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/Tumor+Dissociation+Kit%2C+mouse/pm42531132-267-152-153
    Average 98 stars, based on 2227 article reviews
    mouse miltenyi biotec - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Cream:

    Article Title: Autophagy maintains high endothelial venule identity and function during inflammation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti- Rat Ly6G (1A8) Biolegend Cat# 127601; RRID: AB_1089179 Fluorescein labeled Aleuria Aurantia Lectin Vector Labs VEC.FL-1391 RRID:AB_3752365 AF488 Goat anti-Rabbit Secondary Antibody Invitrogen Cat# A11034; RRID: AB_2576217 AF488 Donkey anti-Rat Secondary Antibody Invitrogen Cat# A21208; RRID: AB_2535794 AF488 Goat anti-Hamster Secondary Antibody Invitrogen Cat# A-21110; RRID: AB_2535759 AF647 Goat anti-Rabbit Secondary Antibody Invitrogen Cat# A21244; RRID: AB_2535812 AF488 Donkey anti-Rabbit Secondary Antibody Invitrogen Cat# A21206; RRID: AB_2535792 Anti-Rabbit CHST4 Aviva systems bio Cat# ARP35787_T100; RRID:AB_841312 Anti-Rabbit CD3 Novus Cat# NB600-1441; RRID: AB_789102 Anti-Goat CD31 R&D Biosystems Cat# AF3628; RRID: AB_2161028 Anti-Mouse LC3B Nanotools Cat# 0231-100; RRID: AB_2722733 Anti- F2-dylight633 Liu et al.29 N/A Mouse LTBR, Fc fusion HiPTM Recombinant Tebubio Cat# 71122; RRID:AB_3752369 Biological samples Human Tonsilitis sample 5686 This paper n/a Human Tonsilitis sample 5727 This paper n/a Human Tonsilitis sample 5730 This paper n/a Human Tonsilitis sample 5805 This paper n/a Human Tonsilitis sample 5823 This paper n/a Human Tonsilitis sample 5808 This paper n/a Human Tonsilitis sample 5804 This paper n/a Human Tonsilitis sample 5698 This paper n/a Human Psoriasis sample L1#79 This paper n/a Human Psoriasis sample L1#84 This paper n/a Human Psoriasis sample L1#90 This paper n/a Human Psoriasis sample L1#82 This paper n/a Human Psoriasis sample L1#66 This paper n/a Human Psoriasis sample L1#80 This paper n/a Human Psoriasis sample L1#68 This paper n/a Human Psoriasis sample L1#87 This paper n/a Other Bovine serum albumin (BSA) ThermoFisher Cat# 10270–106 RPMI Gibco Cat# 21875–034 Fetal bovine serum (FBS) SIgma Cat# B4287 L-Glutamine ThermoFisher Cat# 25030024 Phosphate buffered saline (PBS) ThermoFisher Cat# 14190094 Triton-100 Sigma Cat# T8787 Tween-20 Sigma-Merck Cat# P9416 Tamoxifen Sigma Cat# T5648 10% Neutral buffered formalin Sigma-Merck Cat# HT501128 TopVision Low Melting Point Agarose ThermoFisher Cat# R0801 7-AAD eBioscience Cat# 00-6993-50 Fixable Viability Dye eFluor 780 eBioscience Cat# 65-0865-14 Fixable Viability Dye eFluor 450 eBioscience Cat# 65-0863-14 (Continued on next page) ll OPEN ACCESS Article e2 Immunity 59, 1–18.e1–e8, October 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagenase P Sigma/Merck Cat# 11213857001 DispaseII Sigma Cat# D4693-1G Dnase1 Worthington Cat# LS006333 4-Ethoxymethylene-2-phenyl-2oxazolin-5-one Sigma Cat# 862207 Aldara cream 5% MEDA N/A Critical commercial assays CD45 (TIL) MicroBeads, mouse Miltenyi Cat # 130-110-618 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Thermo scientific Cat# C10634 Depositied data Raw and processed scRNA-seq data (mouse) This paper GEO: GSE300153 Human tonsilitis data set De Martin et al. Biostudies Database: E-MTAB-11715 Mass spectrometry data (mouse) This paper Pride: PXD076099 Experimental models Mouse: Chst4-tdT reporter mice Hua et al.8 N/A Mouse: ATG12lox/lox x Chst4-Cre(ER)T2/ RFP mice This paper N/A Mouse: Ire1α lox/lox xChst4-Cre(ER)T2/ Tomato mice This paper N/A Mouse: CAG-RFP/EGFP/Map1lc3b)1Hill/J Li et al.22, Lin F et al.21 via JAX #027139 Mouse: ATG12 lox/lox Malhotra et al.58 N/A Mouse: ATG7 lox/lox Komatsu et al.59 N/A Mouse: C57BL/6NCrl Charles river Strain Code: 027 Mouse: Cdh5-CreER Sörensen et al.60 N/A Mouse: Ire1α lox/lox Zhang et al.61 N/A Mouse: Ltbr lox/lox Wimmer et al.62 N/A Software and algorithms R version 4.1.0 (2021-05-18) Platform: 386_64-w64-mingw32/364 (64-bit) Running under: Windows 10 3 64 (build 19041) R Core Team https://www.r-project.org Seurat_4.0.3 CRAN https://CRAN.R-project.org/ package=Seurat ggplot2_3.3.5 CRAN https://CRAN.R-project.org/ package=ggplot2 SeuratObject_4.0.2 CRAN https://CRAN.R-project.org/ package=SeuratObject ggpubr_0.4.0 CRAN https://CRAN.R-project.org/ package=ggpubr harmony_0.1.0 CRAN https://CRAN.R-project.org/ package=harmony AUCell_1.14.0 Bioconductor https://bioconductor.org/packages/AUCell GSVA_1.40.1 Bioconductor https:// bioconductor.org/packages/GSVA SeuratExtend_0.5.1 Hua et al.63 https://github.com/huayc09/ SeuratExtendSCENIC Nextflow pipeline Aibar S et al.64 https://github.com/aertslab/scenic-nf Python_3.8.3 Python http://www.python.org/ Palantir_0.2.6 Setty M et al.65 https://github.com/dpeerlab/Palantir Scvelo_0.2.2 Bergen V et al.66 https://scvelo.readthedocs.io/ Velocyto_0.17.17 La Manno G et al.67 http://velocyto.org/ (Continued on next page) ll OPEN ACCESSArticle Immunity 59, 1–18.e1–e8, October 13, 2026 e3 ..

    Flow Cytometry:

    Article Title: Autophagy maintains high endothelial venule identity and function during inflammation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti- Rat Ly6G (1A8) Biolegend Cat# 127601; RRID: AB_1089179 Fluorescein labeled Aleuria Aurantia Lectin Vector Labs VEC.FL-1391 RRID:AB_3752365 AF488 Goat anti-Rabbit Secondary Antibody Invitrogen Cat# A11034; RRID: AB_2576217 AF488 Donkey anti-Rat Secondary Antibody Invitrogen Cat# A21208; RRID: AB_2535794 AF488 Goat anti-Hamster Secondary Antibody Invitrogen Cat# A-21110; RRID: AB_2535759 AF647 Goat anti-Rabbit Secondary Antibody Invitrogen Cat# A21244; RRID: AB_2535812 AF488 Donkey anti-Rabbit Secondary Antibody Invitrogen Cat# A21206; RRID: AB_2535792 Anti-Rabbit CHST4 Aviva systems bio Cat# ARP35787_T100; RRID:AB_841312 Anti-Rabbit CD3 Novus Cat# NB600-1441; RRID: AB_789102 Anti-Goat CD31 R&D Biosystems Cat# AF3628; RRID: AB_2161028 Anti-Mouse LC3B Nanotools Cat# 0231-100; RRID: AB_2722733 Anti- F2-dylight633 Liu et al.29 N/A Mouse LTBR, Fc fusion HiPTM Recombinant Tebubio Cat# 71122; RRID:AB_3752369 Biological samples Human Tonsilitis sample 5686 This paper n/a Human Tonsilitis sample 5727 This paper n/a Human Tonsilitis sample 5730 This paper n/a Human Tonsilitis sample 5805 This paper n/a Human Tonsilitis sample 5823 This paper n/a Human Tonsilitis sample 5808 This paper n/a Human Tonsilitis sample 5804 This paper n/a Human Tonsilitis sample 5698 This paper n/a Human Psoriasis sample L1#79 This paper n/a Human Psoriasis sample L1#84 This paper n/a Human Psoriasis sample L1#90 This paper n/a Human Psoriasis sample L1#82 This paper n/a Human Psoriasis sample L1#66 This paper n/a Human Psoriasis sample L1#80 This paper n/a Human Psoriasis sample L1#68 This paper n/a Human Psoriasis sample L1#87 This paper n/a Other Bovine serum albumin (BSA) ThermoFisher Cat# 10270–106 RPMI Gibco Cat# 21875–034 Fetal bovine serum (FBS) SIgma Cat# B4287 L-Glutamine ThermoFisher Cat# 25030024 Phosphate buffered saline (PBS) ThermoFisher Cat# 14190094 Triton-100 Sigma Cat# T8787 Tween-20 Sigma-Merck Cat# P9416 Tamoxifen Sigma Cat# T5648 10% Neutral buffered formalin Sigma-Merck Cat# HT501128 TopVision Low Melting Point Agarose ThermoFisher Cat# R0801 7-AAD eBioscience Cat# 00-6993-50 Fixable Viability Dye eFluor 780 eBioscience Cat# 65-0865-14 Fixable Viability Dye eFluor 450 eBioscience Cat# 65-0863-14 (Continued on next page) ll OPEN ACCESS Article e2 Immunity 59, 1–18.e1–e8, October 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagenase P Sigma/Merck Cat# 11213857001 DispaseII Sigma Cat# D4693-1G Dnase1 Worthington Cat# LS006333 4-Ethoxymethylene-2-phenyl-2oxazolin-5-one Sigma Cat# 862207 Aldara cream 5% MEDA N/A Critical commercial assays CD45 (TIL) MicroBeads, mouse Miltenyi Cat # 130-110-618 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Thermo scientific Cat# C10634 Depositied data Raw and processed scRNA-seq data (mouse) This paper GEO: GSE300153 Human tonsilitis data set De Martin et al. Biostudies Database: E-MTAB-11715 Mass spectrometry data (mouse) This paper Pride: PXD076099 Experimental models Mouse: Chst4-tdT reporter mice Hua et al.8 N/A Mouse: ATG12lox/lox x Chst4-Cre(ER)T2/ RFP mice This paper N/A Mouse: Ire1α lox/lox xChst4-Cre(ER)T2/ Tomato mice This paper N/A Mouse: CAG-RFP/EGFP/Map1lc3b)1Hill/J Li et al.22, Lin F et al.21 via JAX #027139 Mouse: ATG12 lox/lox Malhotra et al.58 N/A Mouse: ATG7 lox/lox Komatsu et al.59 N/A Mouse: C57BL/6NCrl Charles river Strain Code: 027 Mouse: Cdh5-CreER Sörensen et al.60 N/A Mouse: Ire1α lox/lox Zhang et al.61 N/A Mouse: Ltbr lox/lox Wimmer et al.62 N/A Software and algorithms R version 4.1.0 (2021-05-18) Platform: 386_64-w64-mingw32/364 (64-bit) Running under: Windows 10 3 64 (build 19041) R Core Team https://www.r-project.org Seurat_4.0.3 CRAN https://CRAN.R-project.org/ package=Seurat ggplot2_3.3.5 CRAN https://CRAN.R-project.org/ package=ggplot2 SeuratObject_4.0.2 CRAN https://CRAN.R-project.org/ package=SeuratObject ggpubr_0.4.0 CRAN https://CRAN.R-project.org/ package=ggpubr harmony_0.1.0 CRAN https://CRAN.R-project.org/ package=harmony AUCell_1.14.0 Bioconductor https://bioconductor.org/packages/AUCell GSVA_1.40.1 Bioconductor https:// bioconductor.org/packages/GSVA SeuratExtend_0.5.1 Hua et al.63 https://github.com/huayc09/ SeuratExtendSCENIC Nextflow pipeline Aibar S et al.64 https://github.com/aertslab/scenic-nf Python_3.8.3 Python http://www.python.org/ Palantir_0.2.6 Setty M et al.65 https://github.com/dpeerlab/Palantir Scvelo_0.2.2 Bergen V et al.66 https://scvelo.readthedocs.io/ Velocyto_0.17.17 La Manno G et al.67 http://velocyto.org/ (Continued on next page) ll OPEN ACCESSArticle Immunity 59, 1–18.e1–e8, October 13, 2026 e3 ..

    Mass Spectrometry:

    Article Title: Autophagy maintains high endothelial venule identity and function during inflammation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti- Rat Ly6G (1A8) Biolegend Cat# 127601; RRID: AB_1089179 Fluorescein labeled Aleuria Aurantia Lectin Vector Labs VEC.FL-1391 RRID:AB_3752365 AF488 Goat anti-Rabbit Secondary Antibody Invitrogen Cat# A11034; RRID: AB_2576217 AF488 Donkey anti-Rat Secondary Antibody Invitrogen Cat# A21208; RRID: AB_2535794 AF488 Goat anti-Hamster Secondary Antibody Invitrogen Cat# A-21110; RRID: AB_2535759 AF647 Goat anti-Rabbit Secondary Antibody Invitrogen Cat# A21244; RRID: AB_2535812 AF488 Donkey anti-Rabbit Secondary Antibody Invitrogen Cat# A21206; RRID: AB_2535792 Anti-Rabbit CHST4 Aviva systems bio Cat# ARP35787_T100; RRID:AB_841312 Anti-Rabbit CD3 Novus Cat# NB600-1441; RRID: AB_789102 Anti-Goat CD31 R&D Biosystems Cat# AF3628; RRID: AB_2161028 Anti-Mouse LC3B Nanotools Cat# 0231-100; RRID: AB_2722733 Anti- F2-dylight633 Liu et al.29 N/A Mouse LTBR, Fc fusion HiPTM Recombinant Tebubio Cat# 71122; RRID:AB_3752369 Biological samples Human Tonsilitis sample 5686 This paper n/a Human Tonsilitis sample 5727 This paper n/a Human Tonsilitis sample 5730 This paper n/a Human Tonsilitis sample 5805 This paper n/a Human Tonsilitis sample 5823 This paper n/a Human Tonsilitis sample 5808 This paper n/a Human Tonsilitis sample 5804 This paper n/a Human Tonsilitis sample 5698 This paper n/a Human Psoriasis sample L1#79 This paper n/a Human Psoriasis sample L1#84 This paper n/a Human Psoriasis sample L1#90 This paper n/a Human Psoriasis sample L1#82 This paper n/a Human Psoriasis sample L1#66 This paper n/a Human Psoriasis sample L1#80 This paper n/a Human Psoriasis sample L1#68 This paper n/a Human Psoriasis sample L1#87 This paper n/a Other Bovine serum albumin (BSA) ThermoFisher Cat# 10270–106 RPMI Gibco Cat# 21875–034 Fetal bovine serum (FBS) SIgma Cat# B4287 L-Glutamine ThermoFisher Cat# 25030024 Phosphate buffered saline (PBS) ThermoFisher Cat# 14190094 Triton-100 Sigma Cat# T8787 Tween-20 Sigma-Merck Cat# P9416 Tamoxifen Sigma Cat# T5648 10% Neutral buffered formalin Sigma-Merck Cat# HT501128 TopVision Low Melting Point Agarose ThermoFisher Cat# R0801 7-AAD eBioscience Cat# 00-6993-50 Fixable Viability Dye eFluor 780 eBioscience Cat# 65-0865-14 Fixable Viability Dye eFluor 450 eBioscience Cat# 65-0863-14 (Continued on next page) ll OPEN ACCESS Article e2 Immunity 59, 1–18.e1–e8, October 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagenase P Sigma/Merck Cat# 11213857001 DispaseII Sigma Cat# D4693-1G Dnase1 Worthington Cat# LS006333 4-Ethoxymethylene-2-phenyl-2oxazolin-5-one Sigma Cat# 862207 Aldara cream 5% MEDA N/A Critical commercial assays CD45 (TIL) MicroBeads, mouse Miltenyi Cat # 130-110-618 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Thermo scientific Cat# C10634 Depositied data Raw and processed scRNA-seq data (mouse) This paper GEO: GSE300153 Human tonsilitis data set De Martin et al. Biostudies Database: E-MTAB-11715 Mass spectrometry data (mouse) This paper Pride: PXD076099 Experimental models Mouse: Chst4-tdT reporter mice Hua et al.8 N/A Mouse: ATG12lox/lox x Chst4-Cre(ER)T2/ RFP mice This paper N/A Mouse: Ire1α lox/lox xChst4-Cre(ER)T2/ Tomato mice This paper N/A Mouse: CAG-RFP/EGFP/Map1lc3b)1Hill/J Li et al.22, Lin F et al.21 via JAX #027139 Mouse: ATG12 lox/lox Malhotra et al.58 N/A Mouse: ATG7 lox/lox Komatsu et al.59 N/A Mouse: C57BL/6NCrl Charles river Strain Code: 027 Mouse: Cdh5-CreER Sörensen et al.60 N/A Mouse: Ire1α lox/lox Zhang et al.61 N/A Mouse: Ltbr lox/lox Wimmer et al.62 N/A Software and algorithms R version 4.1.0 (2021-05-18) Platform: 386_64-w64-mingw32/364 (64-bit) Running under: Windows 10 3 64 (build 19041) R Core Team https://www.r-project.org Seurat_4.0.3 CRAN https://CRAN.R-project.org/ package=Seurat ggplot2_3.3.5 CRAN https://CRAN.R-project.org/ package=ggplot2 SeuratObject_4.0.2 CRAN https://CRAN.R-project.org/ package=SeuratObject ggpubr_0.4.0 CRAN https://CRAN.R-project.org/ package=ggpubr harmony_0.1.0 CRAN https://CRAN.R-project.org/ package=harmony AUCell_1.14.0 Bioconductor https://bioconductor.org/packages/AUCell GSVA_1.40.1 Bioconductor https:// bioconductor.org/packages/GSVA SeuratExtend_0.5.1 Hua et al.63 https://github.com/huayc09/ SeuratExtendSCENIC Nextflow pipeline Aibar S et al.64 https://github.com/aertslab/scenic-nf Python_3.8.3 Python http://www.python.org/ Palantir_0.2.6 Setty M et al.65 https://github.com/dpeerlab/Palantir Scvelo_0.2.2 Bergen V et al.66 https://scvelo.readthedocs.io/ Velocyto_0.17.17 La Manno G et al.67 http://velocyto.org/ (Continued on next page) ll OPEN ACCESSArticle Immunity 59, 1–18.e1–e8, October 13, 2026 e3 ..

    Software:

    Article Title: Autophagy maintains high endothelial venule identity and function during inflammation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Anti- Rat Ly6G (1A8) Biolegend Cat# 127601; RRID: AB_1089179 Fluorescein labeled Aleuria Aurantia Lectin Vector Labs VEC.FL-1391 RRID:AB_3752365 AF488 Goat anti-Rabbit Secondary Antibody Invitrogen Cat# A11034; RRID: AB_2576217 AF488 Donkey anti-Rat Secondary Antibody Invitrogen Cat# A21208; RRID: AB_2535794 AF488 Goat anti-Hamster Secondary Antibody Invitrogen Cat# A-21110; RRID: AB_2535759 AF647 Goat anti-Rabbit Secondary Antibody Invitrogen Cat# A21244; RRID: AB_2535812 AF488 Donkey anti-Rabbit Secondary Antibody Invitrogen Cat# A21206; RRID: AB_2535792 Anti-Rabbit CHST4 Aviva systems bio Cat# ARP35787_T100; RRID:AB_841312 Anti-Rabbit CD3 Novus Cat# NB600-1441; RRID: AB_789102 Anti-Goat CD31 R&D Biosystems Cat# AF3628; RRID: AB_2161028 Anti-Mouse LC3B Nanotools Cat# 0231-100; RRID: AB_2722733 Anti- F2-dylight633 Liu et al.29 N/A Mouse LTBR, Fc fusion HiPTM Recombinant Tebubio Cat# 71122; RRID:AB_3752369 Biological samples Human Tonsilitis sample 5686 This paper n/a Human Tonsilitis sample 5727 This paper n/a Human Tonsilitis sample 5730 This paper n/a Human Tonsilitis sample 5805 This paper n/a Human Tonsilitis sample 5823 This paper n/a Human Tonsilitis sample 5808 This paper n/a Human Tonsilitis sample 5804 This paper n/a Human Tonsilitis sample 5698 This paper n/a Human Psoriasis sample L1#79 This paper n/a Human Psoriasis sample L1#84 This paper n/a Human Psoriasis sample L1#90 This paper n/a Human Psoriasis sample L1#82 This paper n/a Human Psoriasis sample L1#66 This paper n/a Human Psoriasis sample L1#80 This paper n/a Human Psoriasis sample L1#68 This paper n/a Human Psoriasis sample L1#87 This paper n/a Other Bovine serum albumin (BSA) ThermoFisher Cat# 10270–106 RPMI Gibco Cat# 21875–034 Fetal bovine serum (FBS) SIgma Cat# B4287 L-Glutamine ThermoFisher Cat# 25030024 Phosphate buffered saline (PBS) ThermoFisher Cat# 14190094 Triton-100 Sigma Cat# T8787 Tween-20 Sigma-Merck Cat# P9416 Tamoxifen Sigma Cat# T5648 10% Neutral buffered formalin Sigma-Merck Cat# HT501128 TopVision Low Melting Point Agarose ThermoFisher Cat# R0801 7-AAD eBioscience Cat# 00-6993-50 Fixable Viability Dye eFluor 780 eBioscience Cat# 65-0865-14 Fixable Viability Dye eFluor 450 eBioscience Cat# 65-0863-14 (Continued on next page) ll OPEN ACCESS Article e2 Immunity 59, 1–18.e1–e8, October 13, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Collagenase P Sigma/Merck Cat# 11213857001 DispaseII Sigma Cat# D4693-1G Dnase1 Worthington Cat# LS006333 4-Ethoxymethylene-2-phenyl-2oxazolin-5-one Sigma Cat# 862207 Aldara cream 5% MEDA N/A Critical commercial assays CD45 (TIL) MicroBeads, mouse Miltenyi Cat # 130-110-618 Click-iTTM Plus EdU Alexa FluorTM 647 Flow Cytometry Thermo scientific Cat# C10634 Depositied data Raw and processed scRNA-seq data (mouse) This paper GEO: GSE300153 Human tonsilitis data set De Martin et al. Biostudies Database: E-MTAB-11715 Mass spectrometry data (mouse) This paper Pride: PXD076099 Experimental models Mouse: Chst4-tdT reporter mice Hua et al.8 N/A Mouse: ATG12lox/lox x Chst4-Cre(ER)T2/ RFP mice This paper N/A Mouse: Ire1α lox/lox xChst4-Cre(ER)T2/ Tomato mice This paper N/A Mouse: CAG-RFP/EGFP/Map1lc3b)1Hill/J Li et al.22, Lin F et al.21 via JAX #027139 Mouse: ATG12 lox/lox Malhotra et al.58 N/A Mouse: ATG7 lox/lox Komatsu et al.59 N/A Mouse: C57BL/6NCrl Charles river Strain Code: 027 Mouse: Cdh5-CreER Sörensen et al.60 N/A Mouse: Ire1α lox/lox Zhang et al.61 N/A Mouse: Ltbr lox/lox Wimmer et al.62 N/A Software and algorithms R version 4.1.0 (2021-05-18) Platform: 386_64-w64-mingw32/364 (64-bit) Running under: Windows 10 3 64 (build 19041) R Core Team https://www.r-project.org Seurat_4.0.3 CRAN https://CRAN.R-project.org/ package=Seurat ggplot2_3.3.5 CRAN https://CRAN.R-project.org/ package=ggplot2 SeuratObject_4.0.2 CRAN https://CRAN.R-project.org/ package=SeuratObject ggpubr_0.4.0 CRAN https://CRAN.R-project.org/ package=ggpubr harmony_0.1.0 CRAN https://CRAN.R-project.org/ package=harmony AUCell_1.14.0 Bioconductor https://bioconductor.org/packages/AUCell GSVA_1.40.1 Bioconductor https:// bioconductor.org/packages/GSVA SeuratExtend_0.5.1 Hua et al.63 https://github.com/huayc09/ SeuratExtendSCENIC Nextflow pipeline Aibar S et al.64 https://github.com/aertslab/scenic-nf Python_3.8.3 Python http://www.python.org/ Palantir_0.2.6 Setty M et al.65 https://github.com/dpeerlab/Palantir Scvelo_0.2.2 Bergen V et al.66 https://scvelo.readthedocs.io/ Velocyto_0.17.17 La Manno G et al.67 http://velocyto.org/ (Continued on next page) ll OPEN ACCESSArticle Immunity 59, 1–18.e1–e8, October 13, 2026 e3 ..

    Synthesized:

    Article Title: Tumor-associated Schwann cell remodeling under metabolic stress via lactate sensing orchestrates pancreatic ductal adenocarcinoma development.
    Article Snippet: Article Tumor-associated Schwann cell remodeling under metabolic stress via lactate sensing orchestrates pancreatic ductal adenocarcinoma development

    Reverse Transcription:

    Article Title: Tumor-associated Schwann cell remodeling under metabolic stress via lactate sensing orchestrates pancreatic ductal adenocarcinoma development.
    Article Snippet: Article Tumor-associated Schwann cell remodeling under metabolic stress via lactate sensing orchestrates pancreatic ductal adenocarcinoma development

    Enzyme-linked Immunosorbent Assay:

    Article Title: Tumor-associated Schwann cell remodeling under metabolic stress via lactate sensing orchestrates pancreatic ductal adenocarcinoma development.
    Article Snippet: Article Tumor-associated Schwann cell remodeling under metabolic stress via lactate sensing orchestrates pancreatic ductal adenocarcinoma development

    AST Assay:

    Article Title: Tumor-associated Schwann cell remodeling under metabolic stress via lactate sensing orchestrates pancreatic ductal adenocarcinoma development.
    Article Snippet: Article Tumor-associated Schwann cell remodeling under metabolic stress via lactate sensing orchestrates pancreatic ductal adenocarcinoma development

    Staining:

    Article Title: Optimization of Erythrocyte Lysis Protocols for Robust and Reproducible T Cell Analysis in Murine Peripheral Blood, Spleen, Lung, and Bone Marrow.
    Article Snippet: .. Antigen Clone Fluorochrome Dilution Surface/intracellular Fixable Viability Stain 620 — FVS620 1:1000 Surface Ghost Dye Violet 540 fixable viability dye — Violet 540 1:5000 Surface CD45 30-F11 PE-Cy7 3:1000 Surface CD3 17A2 BV510 1:200 Surface CD3 17A2 FITC 1:500 Surface CD4 RM4-5 APC 1:800 Surface CD4 GK1.5 PE/Dazzle 594 1:800 Surface CD8a 53-6.7 FITC 1:500 Surface CD8a 53-6.7 APC 1:800 Surface Ghost Dye Violet 540 fixable viability dye TONBO Cat#72086 Anti-CD45 antibody BD Cat#552848 Anti-CD3 antibody BioLegend Cat#100234 Anti-CD3 antibody BioLegend Cat#100204 Anti-CD4 antibody BD Cat#553051 Anti-CD4 antibody BioLegend Cat#100456 Anti-CD8a antibody BioLegend Cat#100706 Anti-CD8a antibody BioLegend Cat#100712 Lysing solution 10x concentrate BD Cat#349202 RBC lysis buffer (10x) BioLegend Cat#420301 Red blood cell lysis buffer Biosharp Cat#BL503B 3% acetic acid with methylene blue Stemcell Cat#07060 Fetal bovine serum (FBS) ExCell Cat#FSP500 Albumin from bovine serum Macklin Cat#B917420-200g Phosphate-buffer saline (PBS) Solarbio Cat#G0002 MACS tissue storage solution Miltenyi Cat#130-100-008 Lung dissociation kit, mouse Miltenyi Cat130-095-927 gentleMACS 25C Tubes C Miltenyi Cat#130-093-237 70 μm cell strainers Biosharp Cat#BS-70-XBS-N1 Heparin sodium anticoagulant tube 1.5mL Solarbio Cat#YA1471 Isoflurane anesthetic RWD Cat#R510-22-10 4 of 19 Journal of Immunology Research, 2026 1607, 2026, 1, D ow nloaded from https://onlinelibrary.w iley.com /doi/10.1155/jim r/3335332 by IN A SP - N E PA L , W iley O nline L ibrary on [10/04/2026]. ..

    Article Title: The transcription factor Helios restrains the anti-tumor capacity of CD8 + T cells.
    Article Snippet: Cas9 Nuclease V3 IDT Cat#1081058 Blasticidin S HCl Invitrogen Cat#R21001 ALV2 MedChemExpress Cat#HY-137206 BNTX maleate Abcam Cat#AB146142 KF 38789 Tocris Bioscience Cat#2748 SUN-B 8155 Tocris Bioscience Cat#2550 Adapalene Merck Cat#A7486 Ghost Dye Red 780 Tonbo Biosciences Cat#13-0865 Ghost Dye Red 710 Tonbo Biosciences Cat#13-0871 (Continued on next page) Cell Reports 44, 116680, December 23, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER SYTOXTM Orange Dead Cell Stain Invitrogen Cat#S34861 Annexin V-APC Tonbo Biosciences Cat#20-6409 Annexin V Binding Buffer Tonbo Biosciences Cat#TNB-5000 Critical commercial assays Foxp3/Transcription Factor Stainning Buffer Kit Tonbo Biosciences Cat#TNB-0607 BD Cytofix/Cytoperm Plus BD Biosciences Cat#555028 TrueTagTM DNA Donor Kit Thermo Fisher Scientific Cat#A42992 Neon NxT Electroporation System Invitrogen Cat#NEON1S CD8a+ T cell Isolation Kit, mouse Miltenyi Cat130-104-075 ATAC-Seq Kit Active Motif Cat#53150 CellTrace Violet Cell Proliferation Kit Thermo Fisher Scientific Cat#C34557 Deposited data scRNA-seq/ATAC-seq PRJEB101308 ENA (EMBL-EBI) Experimental models: Cell lines Jurkat E6.1 ATCC RRID:CVCL_0367 .. MC38 Gift from Dr. Santos Mañés, Centro Nacional de Biotecnologı́a/CSIC, Spain RRID:CVCL_B288 B16-F10 Gift from Dr. Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico RRID:CVCL_F936 B16-F10OVA Gift from Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico N/A HTB-176 Gift from Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Cat#000664; RRID:IMSR_JAX:000664 Mouse: C57BL/6-Tg(Cd8a-cre)1Itan/J The Jackson Laboratory Cat#008766; RRID:IMSR_JAX:008766 Mouse: B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ The Jackson Laboratory Cat#022071; RRID:IMSR_JAX:022071 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID:IMSR_JAX:003831 Mouse: C57BL/6-Tg(CAG-OVAL)916Jen/J The Jackson Laboratory Cat#005145; RRID:IMSR_JAX:005145 Mouse: B6.129S7-Rag1tm1Mom/J The Jackson Laboratory Cat#002216; RRID:IMSR_JAX:002216 Mouse: PD-1− /− Gift from Dr. Arlene H. Sharpe (Harvard Medical School) N/A Mouse: Ikzf2-flox/flox Gift from Dr. Angela Thornton (NIAID) N/A Software and algorithms GraphPad Prism 10.1 GraphPad RRID: SCR_002798 http://www.graphpad.com/ NovoExpress Agilent RRID: SCR_024676 ImageJ NIH https://rsbweb.nih.gov/ij/ Cellpose 2.0 Ref. 64 RRID:SCR_021716; http://www.cellpose.org/ r-tidyverse R/Anaconda https://anaconda.org/conda-forge/r-tidyverse r-dplyr R/Anaconda https://anaconda.org/conda-forge/r-dplyr r-data.table R/Anaconda https://anaconda.org/conda-forge/r-data.table r-ggplot2 R/Anaconda https://anaconda.org/conda-forge/r-ggplot2 r-ggpubr R/Anaconda https://anaconda.org/conda-forge/r-ggpubr MiXCR Ref. 59 https://github.com/milaboratory/mixcr fastqc Anaconda https://anaconda.org/bioconda/fastqc trim-galore Anaconda https://anaconda.org/bioconda/trim-galore samtools Anaconda https://anaconda.org/bioconda/samtools (Continued on next page) 18 Cell Reports 44, 116680, December 23, 2025

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Article Title: Innate lymphoid cells integrate sensing and plasticity to control fungal infections
    Article Snippet: Cat# 65-0840-90 Cyanine5 Streptavidin Biolegend Cat#405209 APC-Fire750 Streptavidin Biolegend Cat#405250 Streptavidin-DyLight 488 (currently marketed as Alexa Fluor 488) Jackson ImmunoResearch Cat#016-540-084 7-AAD Viability Staining Solution Biolegend Cat#420403 Apotracker Green Biolegend Cat#427401 Zombie Aqua Fixable Viability Kit Biolegend Cat#423102 Zombie NIR Fixable Viability Kit Biolegend Cat#423105 Zombie Violet Fixable Viability Kit Biolegend Cat#423113 Collagenase II Gibco; Fisher Scientific Cat# 17101015 DNAse I Sigma-Aldrich Cat#10104159001 Percoll GE-Healthcare Cat#GE17-0891-01 Recombinant Mouse IL-2 Biolegend Cat#575404 Recombinant Mouse IL-7 Biolegend Cat#577802 Recombinant Mouse SCF Miltenyi Cat#130-101-693 Recombinant Mouse IL-1β MedchemExpress Cat# MCE-HY-P7073A-2μg Recombinant Mouse IL-23 Biolegend Cat#589002 Recombinant Mouse IL-17C BioTechne Cat#2306-ML-025 Recombinant Rat/Mouse TGFβ1 MedchemExpress MCE-HY-P7117-2μg Brefeldin A Biolegend Cat#420601 Phorbol myristate acetate (PMA) Sigma-Aldrich Cat#P1585 Ionomycin Sigma-Aldrich Cat#IO634 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D2438 Zymosan Sigma-Aldrich Cat#Z4250 Curdlan Invivogen Cat#tlrl-cura Laminarin Invivogen Cat#tlrl-lam Chitin Wagener et al.115 N/A Dynasore hydrate Sigma-Aldrich Cat#D7693 R406 (Syk Inhibitor) Selleckchem Cat#S2194 α-D-Mannan Sigma-Aldrich Cat#M7504 Ketamin: Ketasol Livisto GTIN# 04050478000336 Xylazine: Sedaxylan Dechra GTIN# 08714225157464 Intracellular Staining Permeabilization Wash Buffer (10X) Biolegend Cat#421002 Fixation Buffer Biolegend Cat#420801 (Continued on next page) 22 Cell Reports 45, 117140, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Red Blood Cell Lysis Buffer (10X) Biolegend Cat#420302 True-Phos Perm Buffer Biolegend Cat#425401 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich Cat#8537 Hanks’ Balanced Salt solution Sigma-Aldrich Cat#8264 IMDM (Iscove’s Modified Dulbecco’s Medium) Lonza Cat#12-722F RPMI 1640 Medium Gibco; Fisher Scientific Cat#21875091 GlutaMAX Supplement Gibco; Fisher Scientific Cat#35050061 HEPES (1M) Gibco; Fisher Scientific Cat#15630080 Sodium pyruvate solution,100 mM Sigma-Aldrich Cat#S8636 MEM Non-essential Amino Acid Solution (100X) Sigma-Aldrich Cat#M7145 RNAlater Sigma-Aldrich Cat#R0901 z-IETD-FMK MedchemExpress Cat#MCE-HY-101297-1mg Necrostatin-1 MedchemExpress Cat#HY-15760 Ultra PureTM Distilled DNAse/RNAse free Water Invitrogen; Fisher Scientific Cat#10977049 Commercial assays Lineage cell depletion kit, mouse Miltenyi Cat130-090-858 Foxp3/Transcription Factor Staining Buffer Set-1 kit eBioscience, Fisher Scient. .. Cat#00-5523-00 System for Reverse Transcription Using AMV RT Promega Cat#A3500 SsoAdvanced Universal SYBR Green Supermix Biorad Cat#1725271 QIAGEN RNeasy Plus Micro Kit Quiagen Cat#74034 Monarch Spin RNA Cleanup Kit (10 μg) New England Biolabs Cat#T2030L Deposited data Mass Spectrometry of culture supernatants (ILC-Cgl interaction) ProteomeXchange Consortium111 PRIDE:PXD061271 Pulmonary ILC Sequencing (Smart-Seq2) GEO-database GEO:GSE293220 RNA-Sequencing of infected lung tissues after ILC-transfer GEO-database GEO:GSE293054 Experimental models cell lines Feeder cells: OP9-DL1 Gift of Meinrad Busslinger Schmitt & Zúñiga-Pflücker116 Experimental murine models, strains Mouse: C57BL/6J mice Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 Mouse: Rag1− /− : B6.129S7-Rag1tm1Mom/J Jackson Laboratory RRID:IMSR_JAX:002096 Mouse: Rag2− /− Il2rg− /− Cao et al.117 Veronika Sexl Mouse: IL17A-IRES-GFP-KI reporter: C57BL/6-Il17atm1Bcgen/J Jackson Laboratory RRID: IMSR_JAX:018472 Mouse: Tec− /− Rag1− /− IL-17AeGFP: C57BL/6Il17atm1Bcgen/J x Tectm1Welm x B6.129S7-Rag1tm1Mom/J This study N/A Mouse: Dectin-1− /− : B6.129S6-Clec7atm1Gdb/J Taylor et al.118 RRID:IMSR_JAX:012337 Mouse: Dectin-2− /− : Clec4ntm1Yiw Saijo et al.119 MGI:4459637 Mouse: Tlr2/− : Tlr2tm1Aki Takeuchi et al.120 MGI:2178675 Mouse: Tlr4− /− : Tlr4tm1Aki Hashino et al.121 MGI:1860885 Mouse: Tec− /− : Tectm1Welm Ellmeier et al.34 MGI:2450883 Oligonucleotides m-Eef1a forward/reverse (5′-3′): ACGAGGCAATGTTG CTGGTGAC/GTGTGACAATCCAGAACAGGAGC Origene Cat#MP204369; GenBank:NM_010106 m-Tgfb1 forward/reverse (5′-3′): TGACGTCACTGGA GTTGTACGG/GGTTCATGTCATGGATGGTGC N/A GenBank:NM_011577.2 m-Il1b forward/reverse (5′-3′): (CCAACAAGTGATAT TCTCCATGAG/TCTTTCATTACACAGGACAGGT) N/A GenBank:NM_008361.4 (Continued on next page) Cell Reports 45, 117140, April 28, 2026 23

    Red Blood Cell Lysis:

    Article Title: Optimization of Erythrocyte Lysis Protocols for Robust and Reproducible T Cell Analysis in Murine Peripheral Blood, Spleen, Lung, and Bone Marrow.
    Article Snippet: .. Antigen Clone Fluorochrome Dilution Surface/intracellular Fixable Viability Stain 620 — FVS620 1:1000 Surface Ghost Dye Violet 540 fixable viability dye — Violet 540 1:5000 Surface CD45 30-F11 PE-Cy7 3:1000 Surface CD3 17A2 BV510 1:200 Surface CD3 17A2 FITC 1:500 Surface CD4 RM4-5 APC 1:800 Surface CD4 GK1.5 PE/Dazzle 594 1:800 Surface CD8a 53-6.7 FITC 1:500 Surface CD8a 53-6.7 APC 1:800 Surface Ghost Dye Violet 540 fixable viability dye TONBO Cat#72086 Anti-CD45 antibody BD Cat#552848 Anti-CD3 antibody BioLegend Cat#100234 Anti-CD3 antibody BioLegend Cat#100204 Anti-CD4 antibody BD Cat#553051 Anti-CD4 antibody BioLegend Cat#100456 Anti-CD8a antibody BioLegend Cat#100706 Anti-CD8a antibody BioLegend Cat#100712 Lysing solution 10x concentrate BD Cat#349202 RBC lysis buffer (10x) BioLegend Cat#420301 Red blood cell lysis buffer Biosharp Cat#BL503B 3% acetic acid with methylene blue Stemcell Cat#07060 Fetal bovine serum (FBS) ExCell Cat#FSP500 Albumin from bovine serum Macklin Cat#B917420-200g Phosphate-buffer saline (PBS) Solarbio Cat#G0002 MACS tissue storage solution Miltenyi Cat#130-100-008 Lung dissociation kit, mouse Miltenyi Cat130-095-927 gentleMACS 25C Tubes C Miltenyi Cat#130-093-237 70 μm cell strainers Biosharp Cat#BS-70-XBS-N1 Heparin sodium anticoagulant tube 1.5mL Solarbio Cat#YA1471 Isoflurane anesthetic RWD Cat#R510-22-10 4 of 19 Journal of Immunology Research, 2026 1607, 2026, 1, D ow nloaded from https://onlinelibrary.w iley.com /doi/10.1155/jim r/3335332 by IN A SP - N E PA L , W iley O nline L ibrary on [10/04/2026]. ..

    Article Title: Innate lymphoid cells integrate sensing and plasticity to control fungal infections
    Article Snippet: Cat# 65-0840-90 Cyanine5 Streptavidin Biolegend Cat#405209 APC-Fire750 Streptavidin Biolegend Cat#405250 Streptavidin-DyLight 488 (currently marketed as Alexa Fluor 488) Jackson ImmunoResearch Cat#016-540-084 7-AAD Viability Staining Solution Biolegend Cat#420403 Apotracker Green Biolegend Cat#427401 Zombie Aqua Fixable Viability Kit Biolegend Cat#423102 Zombie NIR Fixable Viability Kit Biolegend Cat#423105 Zombie Violet Fixable Viability Kit Biolegend Cat#423113 Collagenase II Gibco; Fisher Scientific Cat# 17101015 DNAse I Sigma-Aldrich Cat#10104159001 Percoll GE-Healthcare Cat#GE17-0891-01 Recombinant Mouse IL-2 Biolegend Cat#575404 Recombinant Mouse IL-7 Biolegend Cat#577802 Recombinant Mouse SCF Miltenyi Cat#130-101-693 Recombinant Mouse IL-1β MedchemExpress Cat# MCE-HY-P7073A-2μg Recombinant Mouse IL-23 Biolegend Cat#589002 Recombinant Mouse IL-17C BioTechne Cat#2306-ML-025 Recombinant Rat/Mouse TGFβ1 MedchemExpress MCE-HY-P7117-2μg Brefeldin A Biolegend Cat#420601 Phorbol myristate acetate (PMA) Sigma-Aldrich Cat#P1585 Ionomycin Sigma-Aldrich Cat#IO634 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D2438 Zymosan Sigma-Aldrich Cat#Z4250 Curdlan Invivogen Cat#tlrl-cura Laminarin Invivogen Cat#tlrl-lam Chitin Wagener et al.115 N/A Dynasore hydrate Sigma-Aldrich Cat#D7693 R406 (Syk Inhibitor) Selleckchem Cat#S2194 α-D-Mannan Sigma-Aldrich Cat#M7504 Ketamin: Ketasol Livisto GTIN# 04050478000336 Xylazine: Sedaxylan Dechra GTIN# 08714225157464 Intracellular Staining Permeabilization Wash Buffer (10X) Biolegend Cat#421002 Fixation Buffer Biolegend Cat#420801 (Continued on next page) 22 Cell Reports 45, 117140, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Red Blood Cell Lysis Buffer (10X) Biolegend Cat#420302 True-Phos Perm Buffer Biolegend Cat#425401 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich Cat#8537 Hanks’ Balanced Salt solution Sigma-Aldrich Cat#8264 IMDM (Iscove’s Modified Dulbecco’s Medium) Lonza Cat#12-722F RPMI 1640 Medium Gibco; Fisher Scientific Cat#21875091 GlutaMAX Supplement Gibco; Fisher Scientific Cat#35050061 HEPES (1M) Gibco; Fisher Scientific Cat#15630080 Sodium pyruvate solution,100 mM Sigma-Aldrich Cat#S8636 MEM Non-essential Amino Acid Solution (100X) Sigma-Aldrich Cat#M7145 RNAlater Sigma-Aldrich Cat#R0901 z-IETD-FMK MedchemExpress Cat#MCE-HY-101297-1mg Necrostatin-1 MedchemExpress Cat#HY-15760 Ultra PureTM Distilled DNAse/RNAse free Water Invitrogen; Fisher Scientific Cat#10977049 Commercial assays Lineage cell depletion kit, mouse Miltenyi Cat130-090-858 Foxp3/Transcription Factor Staining Buffer Set-1 kit eBioscience, Fisher Scient. .. Cat#00-5523-00 System for Reverse Transcription Using AMV RT Promega Cat#A3500 SsoAdvanced Universal SYBR Green Supermix Biorad Cat#1725271 QIAGEN RNeasy Plus Micro Kit Quiagen Cat#74034 Monarch Spin RNA Cleanup Kit (10 μg) New England Biolabs Cat#T2030L Deposited data Mass Spectrometry of culture supernatants (ILC-Cgl interaction) ProteomeXchange Consortium111 PRIDE:PXD061271 Pulmonary ILC Sequencing (Smart-Seq2) GEO-database GEO:GSE293220 RNA-Sequencing of infected lung tissues after ILC-transfer GEO-database GEO:GSE293054 Experimental models cell lines Feeder cells: OP9-DL1 Gift of Meinrad Busslinger Schmitt & Zúñiga-Pflücker116 Experimental murine models, strains Mouse: C57BL/6J mice Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 Mouse: Rag1− /− : B6.129S7-Rag1tm1Mom/J Jackson Laboratory RRID:IMSR_JAX:002096 Mouse: Rag2− /− Il2rg− /− Cao et al.117 Veronika Sexl Mouse: IL17A-IRES-GFP-KI reporter: C57BL/6-Il17atm1Bcgen/J Jackson Laboratory RRID: IMSR_JAX:018472 Mouse: Tec− /− Rag1− /− IL-17AeGFP: C57BL/6Il17atm1Bcgen/J x Tectm1Welm x B6.129S7-Rag1tm1Mom/J This study N/A Mouse: Dectin-1− /− : B6.129S6-Clec7atm1Gdb/J Taylor et al.118 RRID:IMSR_JAX:012337 Mouse: Dectin-2− /− : Clec4ntm1Yiw Saijo et al.119 MGI:4459637 Mouse: Tlr2/− : Tlr2tm1Aki Takeuchi et al.120 MGI:2178675 Mouse: Tlr4− /− : Tlr4tm1Aki Hashino et al.121 MGI:1860885 Mouse: Tec− /− : Tectm1Welm Ellmeier et al.34 MGI:2450883 Oligonucleotides m-Eef1a forward/reverse (5′-3′): ACGAGGCAATGTTG CTGGTGAC/GTGTGACAATCCAGAACAGGAGC Origene Cat#MP204369; GenBank:NM_010106 m-Tgfb1 forward/reverse (5′-3′): TGACGTCACTGGA GTTGTACGG/GGTTCATGTCATGGATGGTGC N/A GenBank:NM_011577.2 m-Il1b forward/reverse (5′-3′): (CCAACAAGTGATAT TCTCCATGAG/TCTTTCATTACACAGGACAGGT) N/A GenBank:NM_008361.4 (Continued on next page) Cell Reports 45, 117140, April 28, 2026 23

    Saline:

    Article Title: Optimization of Erythrocyte Lysis Protocols for Robust and Reproducible T Cell Analysis in Murine Peripheral Blood, Spleen, Lung, and Bone Marrow.
    Article Snippet: .. Antigen Clone Fluorochrome Dilution Surface/intracellular Fixable Viability Stain 620 — FVS620 1:1000 Surface Ghost Dye Violet 540 fixable viability dye — Violet 540 1:5000 Surface CD45 30-F11 PE-Cy7 3:1000 Surface CD3 17A2 BV510 1:200 Surface CD3 17A2 FITC 1:500 Surface CD4 RM4-5 APC 1:800 Surface CD4 GK1.5 PE/Dazzle 594 1:800 Surface CD8a 53-6.7 FITC 1:500 Surface CD8a 53-6.7 APC 1:800 Surface Ghost Dye Violet 540 fixable viability dye TONBO Cat#72086 Anti-CD45 antibody BD Cat#552848 Anti-CD3 antibody BioLegend Cat#100234 Anti-CD3 antibody BioLegend Cat#100204 Anti-CD4 antibody BD Cat#553051 Anti-CD4 antibody BioLegend Cat#100456 Anti-CD8a antibody BioLegend Cat#100706 Anti-CD8a antibody BioLegend Cat#100712 Lysing solution 10x concentrate BD Cat#349202 RBC lysis buffer (10x) BioLegend Cat#420301 Red blood cell lysis buffer Biosharp Cat#BL503B 3% acetic acid with methylene blue Stemcell Cat#07060 Fetal bovine serum (FBS) ExCell Cat#FSP500 Albumin from bovine serum Macklin Cat#B917420-200g Phosphate-buffer saline (PBS) Solarbio Cat#G0002 MACS tissue storage solution Miltenyi Cat#130-100-008 Lung dissociation kit, mouse Miltenyi Cat130-095-927 gentleMACS 25C Tubes C Miltenyi Cat#130-093-237 70 μm cell strainers Biosharp Cat#BS-70-XBS-N1 Heparin sodium anticoagulant tube 1.5mL Solarbio Cat#YA1471 Isoflurane anesthetic RWD Cat#R510-22-10 4 of 19 Journal of Immunology Research, 2026 1607, 2026, 1, D ow nloaded from https://onlinelibrary.w iley.com /doi/10.1155/jim r/3335332 by IN A SP - N E PA L , W iley O nline L ibrary on [10/04/2026]. ..

    Article Title: Innate lymphoid cells integrate sensing and plasticity to control fungal infections
    Article Snippet: Cat# 65-0840-90 Cyanine5 Streptavidin Biolegend Cat#405209 APC-Fire750 Streptavidin Biolegend Cat#405250 Streptavidin-DyLight 488 (currently marketed as Alexa Fluor 488) Jackson ImmunoResearch Cat#016-540-084 7-AAD Viability Staining Solution Biolegend Cat#420403 Apotracker Green Biolegend Cat#427401 Zombie Aqua Fixable Viability Kit Biolegend Cat#423102 Zombie NIR Fixable Viability Kit Biolegend Cat#423105 Zombie Violet Fixable Viability Kit Biolegend Cat#423113 Collagenase II Gibco; Fisher Scientific Cat# 17101015 DNAse I Sigma-Aldrich Cat#10104159001 Percoll GE-Healthcare Cat#GE17-0891-01 Recombinant Mouse IL-2 Biolegend Cat#575404 Recombinant Mouse IL-7 Biolegend Cat#577802 Recombinant Mouse SCF Miltenyi Cat#130-101-693 Recombinant Mouse IL-1β MedchemExpress Cat# MCE-HY-P7073A-2μg Recombinant Mouse IL-23 Biolegend Cat#589002 Recombinant Mouse IL-17C BioTechne Cat#2306-ML-025 Recombinant Rat/Mouse TGFβ1 MedchemExpress MCE-HY-P7117-2μg Brefeldin A Biolegend Cat#420601 Phorbol myristate acetate (PMA) Sigma-Aldrich Cat#P1585 Ionomycin Sigma-Aldrich Cat#IO634 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D2438 Zymosan Sigma-Aldrich Cat#Z4250 Curdlan Invivogen Cat#tlrl-cura Laminarin Invivogen Cat#tlrl-lam Chitin Wagener et al.115 N/A Dynasore hydrate Sigma-Aldrich Cat#D7693 R406 (Syk Inhibitor) Selleckchem Cat#S2194 α-D-Mannan Sigma-Aldrich Cat#M7504 Ketamin: Ketasol Livisto GTIN# 04050478000336 Xylazine: Sedaxylan Dechra GTIN# 08714225157464 Intracellular Staining Permeabilization Wash Buffer (10X) Biolegend Cat#421002 Fixation Buffer Biolegend Cat#420801 (Continued on next page) 22 Cell Reports 45, 117140, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Red Blood Cell Lysis Buffer (10X) Biolegend Cat#420302 True-Phos Perm Buffer Biolegend Cat#425401 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich Cat#8537 Hanks’ Balanced Salt solution Sigma-Aldrich Cat#8264 IMDM (Iscove’s Modified Dulbecco’s Medium) Lonza Cat#12-722F RPMI 1640 Medium Gibco; Fisher Scientific Cat#21875091 GlutaMAX Supplement Gibco; Fisher Scientific Cat#35050061 HEPES (1M) Gibco; Fisher Scientific Cat#15630080 Sodium pyruvate solution,100 mM Sigma-Aldrich Cat#S8636 MEM Non-essential Amino Acid Solution (100X) Sigma-Aldrich Cat#M7145 RNAlater Sigma-Aldrich Cat#R0901 z-IETD-FMK MedchemExpress Cat#MCE-HY-101297-1mg Necrostatin-1 MedchemExpress Cat#HY-15760 Ultra PureTM Distilled DNAse/RNAse free Water Invitrogen; Fisher Scientific Cat#10977049 Commercial assays Lineage cell depletion kit, mouse Miltenyi Cat130-090-858 Foxp3/Transcription Factor Staining Buffer Set-1 kit eBioscience, Fisher Scient. .. Cat#00-5523-00 System for Reverse Transcription Using AMV RT Promega Cat#A3500 SsoAdvanced Universal SYBR Green Supermix Biorad Cat#1725271 QIAGEN RNeasy Plus Micro Kit Quiagen Cat#74034 Monarch Spin RNA Cleanup Kit (10 μg) New England Biolabs Cat#T2030L Deposited data Mass Spectrometry of culture supernatants (ILC-Cgl interaction) ProteomeXchange Consortium111 PRIDE:PXD061271 Pulmonary ILC Sequencing (Smart-Seq2) GEO-database GEO:GSE293220 RNA-Sequencing of infected lung tissues after ILC-transfer GEO-database GEO:GSE293054 Experimental models cell lines Feeder cells: OP9-DL1 Gift of Meinrad Busslinger Schmitt & Zúñiga-Pflücker116 Experimental murine models, strains Mouse: C57BL/6J mice Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 Mouse: Rag1− /− : B6.129S7-Rag1tm1Mom/J Jackson Laboratory RRID:IMSR_JAX:002096 Mouse: Rag2− /− Il2rg− /− Cao et al.117 Veronika Sexl Mouse: IL17A-IRES-GFP-KI reporter: C57BL/6-Il17atm1Bcgen/J Jackson Laboratory RRID: IMSR_JAX:018472 Mouse: Tec− /− Rag1− /− IL-17AeGFP: C57BL/6Il17atm1Bcgen/J x Tectm1Welm x B6.129S7-Rag1tm1Mom/J This study N/A Mouse: Dectin-1− /− : B6.129S6-Clec7atm1Gdb/J Taylor et al.118 RRID:IMSR_JAX:012337 Mouse: Dectin-2− /− : Clec4ntm1Yiw Saijo et al.119 MGI:4459637 Mouse: Tlr2/− : Tlr2tm1Aki Takeuchi et al.120 MGI:2178675 Mouse: Tlr4− /− : Tlr4tm1Aki Hashino et al.121 MGI:1860885 Mouse: Tec− /− : Tectm1Welm Ellmeier et al.34 MGI:2450883 Oligonucleotides m-Eef1a forward/reverse (5′-3′): ACGAGGCAATGTTG CTGGTGAC/GTGTGACAATCCAGAACAGGAGC Origene Cat#MP204369; GenBank:NM_010106 m-Tgfb1 forward/reverse (5′-3′): TGACGTCACTGGA GTTGTACGG/GGTTCATGTCATGGATGGTGC N/A GenBank:NM_011577.2 m-Il1b forward/reverse (5′-3′): (CCAACAAGTGATAT TCTCCATGAG/TCTTTCATTACACAGGACAGGT) N/A GenBank:NM_008361.4 (Continued on next page) Cell Reports 45, 117140, April 28, 2026 23

    Magnetic Cell Separation:

    Article Title: Optimization of Erythrocyte Lysis Protocols for Robust and Reproducible T Cell Analysis in Murine Peripheral Blood, Spleen, Lung, and Bone Marrow.
    Article Snippet: .. Antigen Clone Fluorochrome Dilution Surface/intracellular Fixable Viability Stain 620 — FVS620 1:1000 Surface Ghost Dye Violet 540 fixable viability dye — Violet 540 1:5000 Surface CD45 30-F11 PE-Cy7 3:1000 Surface CD3 17A2 BV510 1:200 Surface CD3 17A2 FITC 1:500 Surface CD4 RM4-5 APC 1:800 Surface CD4 GK1.5 PE/Dazzle 594 1:800 Surface CD8a 53-6.7 FITC 1:500 Surface CD8a 53-6.7 APC 1:800 Surface Ghost Dye Violet 540 fixable viability dye TONBO Cat#72086 Anti-CD45 antibody BD Cat#552848 Anti-CD3 antibody BioLegend Cat#100234 Anti-CD3 antibody BioLegend Cat#100204 Anti-CD4 antibody BD Cat#553051 Anti-CD4 antibody BioLegend Cat#100456 Anti-CD8a antibody BioLegend Cat#100706 Anti-CD8a antibody BioLegend Cat#100712 Lysing solution 10x concentrate BD Cat#349202 RBC lysis buffer (10x) BioLegend Cat#420301 Red blood cell lysis buffer Biosharp Cat#BL503B 3% acetic acid with methylene blue Stemcell Cat#07060 Fetal bovine serum (FBS) ExCell Cat#FSP500 Albumin from bovine serum Macklin Cat#B917420-200g Phosphate-buffer saline (PBS) Solarbio Cat#G0002 MACS tissue storage solution Miltenyi Cat#130-100-008 Lung dissociation kit, mouse Miltenyi Cat130-095-927 gentleMACS 25C Tubes C Miltenyi Cat#130-093-237 70 μm cell strainers Biosharp Cat#BS-70-XBS-N1 Heparin sodium anticoagulant tube 1.5mL Solarbio Cat#YA1471 Isoflurane anesthetic RWD Cat#R510-22-10 4 of 19 Journal of Immunology Research, 2026 1607, 2026, 1, D ow nloaded from https://onlinelibrary.w iley.com /doi/10.1155/jim r/3335332 by IN A SP - N E PA L , W iley O nline L ibrary on [10/04/2026]. ..

    Binding Assay:

    Article Title: The transcription factor Helios restrains the anti-tumor capacity of CD8 + T cells.
    Article Snippet: Cas9 Nuclease V3 IDT Cat#1081058 Blasticidin S HCl Invitrogen Cat#R21001 ALV2 MedChemExpress Cat#HY-137206 BNTX maleate Abcam Cat#AB146142 KF 38789 Tocris Bioscience Cat#2748 SUN-B 8155 Tocris Bioscience Cat#2550 Adapalene Merck Cat#A7486 Ghost Dye Red 780 Tonbo Biosciences Cat#13-0865 Ghost Dye Red 710 Tonbo Biosciences Cat#13-0871 (Continued on next page) Cell Reports 44, 116680, December 23, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER SYTOXTM Orange Dead Cell Stain Invitrogen Cat#S34861 Annexin V-APC Tonbo Biosciences Cat#20-6409 Annexin V Binding Buffer Tonbo Biosciences Cat#TNB-5000 Critical commercial assays Foxp3/Transcription Factor Stainning Buffer Kit Tonbo Biosciences Cat#TNB-0607 BD Cytofix/Cytoperm Plus BD Biosciences Cat#555028 TrueTagTM DNA Donor Kit Thermo Fisher Scientific Cat#A42992 Neon NxT Electroporation System Invitrogen Cat#NEON1S CD8a+ T cell Isolation Kit, mouse Miltenyi Cat130-104-075 ATAC-Seq Kit Active Motif Cat#53150 CellTrace Violet Cell Proliferation Kit Thermo Fisher Scientific Cat#C34557 Deposited data scRNA-seq/ATAC-seq PRJEB101308 ENA (EMBL-EBI) Experimental models: Cell lines Jurkat E6.1 ATCC RRID:CVCL_0367 .. MC38 Gift from Dr. Santos Mañés, Centro Nacional de Biotecnologı́a/CSIC, Spain RRID:CVCL_B288 B16-F10 Gift from Dr. Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico RRID:CVCL_F936 B16-F10OVA Gift from Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico N/A HTB-176 Gift from Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Cat#000664; RRID:IMSR_JAX:000664 Mouse: C57BL/6-Tg(Cd8a-cre)1Itan/J The Jackson Laboratory Cat#008766; RRID:IMSR_JAX:008766 Mouse: B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ The Jackson Laboratory Cat#022071; RRID:IMSR_JAX:022071 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID:IMSR_JAX:003831 Mouse: C57BL/6-Tg(CAG-OVAL)916Jen/J The Jackson Laboratory Cat#005145; RRID:IMSR_JAX:005145 Mouse: B6.129S7-Rag1tm1Mom/J The Jackson Laboratory Cat#002216; RRID:IMSR_JAX:002216 Mouse: PD-1− /− Gift from Dr. Arlene H. Sharpe (Harvard Medical School) N/A Mouse: Ikzf2-flox/flox Gift from Dr. Angela Thornton (NIAID) N/A Software and algorithms GraphPad Prism 10.1 GraphPad RRID: SCR_002798 http://www.graphpad.com/ NovoExpress Agilent RRID: SCR_024676 ImageJ NIH https://rsbweb.nih.gov/ij/ Cellpose 2.0 Ref. 64 RRID:SCR_021716; http://www.cellpose.org/ r-tidyverse R/Anaconda https://anaconda.org/conda-forge/r-tidyverse r-dplyr R/Anaconda https://anaconda.org/conda-forge/r-dplyr r-data.table R/Anaconda https://anaconda.org/conda-forge/r-data.table r-ggplot2 R/Anaconda https://anaconda.org/conda-forge/r-ggplot2 r-ggpubr R/Anaconda https://anaconda.org/conda-forge/r-ggpubr MiXCR Ref. 59 https://github.com/milaboratory/mixcr fastqc Anaconda https://anaconda.org/bioconda/fastqc trim-galore Anaconda https://anaconda.org/bioconda/trim-galore samtools Anaconda https://anaconda.org/bioconda/samtools (Continued on next page) 18 Cell Reports 44, 116680, December 23, 2025

    Electroporation:

    Article Title: The transcription factor Helios restrains the anti-tumor capacity of CD8 + T cells.
    Article Snippet: Cas9 Nuclease V3 IDT Cat#1081058 Blasticidin S HCl Invitrogen Cat#R21001 ALV2 MedChemExpress Cat#HY-137206 BNTX maleate Abcam Cat#AB146142 KF 38789 Tocris Bioscience Cat#2748 SUN-B 8155 Tocris Bioscience Cat#2550 Adapalene Merck Cat#A7486 Ghost Dye Red 780 Tonbo Biosciences Cat#13-0865 Ghost Dye Red 710 Tonbo Biosciences Cat#13-0871 (Continued on next page) Cell Reports 44, 116680, December 23, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER SYTOXTM Orange Dead Cell Stain Invitrogen Cat#S34861 Annexin V-APC Tonbo Biosciences Cat#20-6409 Annexin V Binding Buffer Tonbo Biosciences Cat#TNB-5000 Critical commercial assays Foxp3/Transcription Factor Stainning Buffer Kit Tonbo Biosciences Cat#TNB-0607 BD Cytofix/Cytoperm Plus BD Biosciences Cat#555028 TrueTagTM DNA Donor Kit Thermo Fisher Scientific Cat#A42992 Neon NxT Electroporation System Invitrogen Cat#NEON1S CD8a+ T cell Isolation Kit, mouse Miltenyi Cat130-104-075 ATAC-Seq Kit Active Motif Cat#53150 CellTrace Violet Cell Proliferation Kit Thermo Fisher Scientific Cat#C34557 Deposited data scRNA-seq/ATAC-seq PRJEB101308 ENA (EMBL-EBI) Experimental models: Cell lines Jurkat E6.1 ATCC RRID:CVCL_0367 .. MC38 Gift from Dr. Santos Mañés, Centro Nacional de Biotecnologı́a/CSIC, Spain RRID:CVCL_B288 B16-F10 Gift from Dr. Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico RRID:CVCL_F936 B16-F10OVA Gift from Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico N/A HTB-176 Gift from Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Cat#000664; RRID:IMSR_JAX:000664 Mouse: C57BL/6-Tg(Cd8a-cre)1Itan/J The Jackson Laboratory Cat#008766; RRID:IMSR_JAX:008766 Mouse: B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ The Jackson Laboratory Cat#022071; RRID:IMSR_JAX:022071 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID:IMSR_JAX:003831 Mouse: C57BL/6-Tg(CAG-OVAL)916Jen/J The Jackson Laboratory Cat#005145; RRID:IMSR_JAX:005145 Mouse: B6.129S7-Rag1tm1Mom/J The Jackson Laboratory Cat#002216; RRID:IMSR_JAX:002216 Mouse: PD-1− /− Gift from Dr. Arlene H. Sharpe (Harvard Medical School) N/A Mouse: Ikzf2-flox/flox Gift from Dr. Angela Thornton (NIAID) N/A Software and algorithms GraphPad Prism 10.1 GraphPad RRID: SCR_002798 http://www.graphpad.com/ NovoExpress Agilent RRID: SCR_024676 ImageJ NIH https://rsbweb.nih.gov/ij/ Cellpose 2.0 Ref. 64 RRID:SCR_021716; http://www.cellpose.org/ r-tidyverse R/Anaconda https://anaconda.org/conda-forge/r-tidyverse r-dplyr R/Anaconda https://anaconda.org/conda-forge/r-dplyr r-data.table R/Anaconda https://anaconda.org/conda-forge/r-data.table r-ggplot2 R/Anaconda https://anaconda.org/conda-forge/r-ggplot2 r-ggpubr R/Anaconda https://anaconda.org/conda-forge/r-ggpubr MiXCR Ref. 59 https://github.com/milaboratory/mixcr fastqc Anaconda https://anaconda.org/bioconda/fastqc trim-galore Anaconda https://anaconda.org/bioconda/trim-galore samtools Anaconda https://anaconda.org/bioconda/samtools (Continued on next page) 18 Cell Reports 44, 116680, December 23, 2025

    Cell Isolation:

    Article Title: The transcription factor Helios restrains the anti-tumor capacity of CD8 + T cells.
    Article Snippet: Cas9 Nuclease V3 IDT Cat#1081058 Blasticidin S HCl Invitrogen Cat#R21001 ALV2 MedChemExpress Cat#HY-137206 BNTX maleate Abcam Cat#AB146142 KF 38789 Tocris Bioscience Cat#2748 SUN-B 8155 Tocris Bioscience Cat#2550 Adapalene Merck Cat#A7486 Ghost Dye Red 780 Tonbo Biosciences Cat#13-0865 Ghost Dye Red 710 Tonbo Biosciences Cat#13-0871 (Continued on next page) Cell Reports 44, 116680, December 23, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER SYTOXTM Orange Dead Cell Stain Invitrogen Cat#S34861 Annexin V-APC Tonbo Biosciences Cat#20-6409 Annexin V Binding Buffer Tonbo Biosciences Cat#TNB-5000 Critical commercial assays Foxp3/Transcription Factor Stainning Buffer Kit Tonbo Biosciences Cat#TNB-0607 BD Cytofix/Cytoperm Plus BD Biosciences Cat#555028 TrueTagTM DNA Donor Kit Thermo Fisher Scientific Cat#A42992 Neon NxT Electroporation System Invitrogen Cat#NEON1S CD8a+ T cell Isolation Kit, mouse Miltenyi Cat130-104-075 ATAC-Seq Kit Active Motif Cat#53150 CellTrace Violet Cell Proliferation Kit Thermo Fisher Scientific Cat#C34557 Deposited data scRNA-seq/ATAC-seq PRJEB101308 ENA (EMBL-EBI) Experimental models: Cell lines Jurkat E6.1 ATCC RRID:CVCL_0367 .. MC38 Gift from Dr. Santos Mañés, Centro Nacional de Biotecnologı́a/CSIC, Spain RRID:CVCL_B288 B16-F10 Gift from Dr. Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico RRID:CVCL_F936 B16-F10OVA Gift from Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico N/A HTB-176 Gift from Laura Bonifaz, Instituto Mexicano del Seguro Social, Mexico N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Cat#000664; RRID:IMSR_JAX:000664 Mouse: C57BL/6-Tg(Cd8a-cre)1Itan/J The Jackson Laboratory Cat#008766; RRID:IMSR_JAX:008766 Mouse: B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ The Jackson Laboratory Cat#022071; RRID:IMSR_JAX:022071 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J The Jackson Laboratory Cat#003831; RRID:IMSR_JAX:003831 Mouse: C57BL/6-Tg(CAG-OVAL)916Jen/J The Jackson Laboratory Cat#005145; RRID:IMSR_JAX:005145 Mouse: B6.129S7-Rag1tm1Mom/J The Jackson Laboratory Cat#002216; RRID:IMSR_JAX:002216 Mouse: PD-1− /− Gift from Dr. Arlene H. Sharpe (Harvard Medical School) N/A Mouse: Ikzf2-flox/flox Gift from Dr. Angela Thornton (NIAID) N/A Software and algorithms GraphPad Prism 10.1 GraphPad RRID: SCR_002798 http://www.graphpad.com/ NovoExpress Agilent RRID: SCR_024676 ImageJ NIH https://rsbweb.nih.gov/ij/ Cellpose 2.0 Ref. 64 RRID:SCR_021716; http://www.cellpose.org/ r-tidyverse R/Anaconda https://anaconda.org/conda-forge/r-tidyverse r-dplyr R/Anaconda https://anaconda.org/conda-forge/r-dplyr r-data.table R/Anaconda https://anaconda.org/conda-forge/r-data.table r-ggplot2 R/Anaconda https://anaconda.org/conda-forge/r-ggplot2 r-ggpubr R/Anaconda https://anaconda.org/conda-forge/r-ggpubr MiXCR Ref. 59 https://github.com/milaboratory/mixcr fastqc Anaconda https://anaconda.org/bioconda/fastqc trim-galore Anaconda https://anaconda.org/bioconda/trim-galore samtools Anaconda https://anaconda.org/bioconda/samtools (Continued on next page) 18 Cell Reports 44, 116680, December 23, 2025

    other:

    Article Title: An SPP1-SOCS1 pathway constrains interferon responses in tumor-associated macrophages and shapes an immunosuppressive tumor microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Protein Transport Inhibitor BD Bioscience Cat#555029 BD HorizonTM Brilliant Stain Buffer BD Bioscience Cat#566349 Recombinant Mouse Osteopontin/OPN Protein R&D Cat#441-OP-050 Recombinant Osteopontin/OPN, Mouse (HEK293, His) MCE Cat#HY-P78358 Recombinant IFN-alpha 14, Mouse MCE Cat#HY-P76401 Recombinant IFN-beta, Mouse MCE Cat#HY-P73130 Recombinant IFN-gamma, Mouse MCE Cat#HY-P70667 Azoxymethane (AOM) MP Biomedicals Cat#2180139.1 Dextran Sodium Sulfate (DSS) MP Biomedical Cat#216011080 SIS3 SELLECK Cat#S7959 Stattic MCE Cat#HY-13818 Galunisertib MCE Cat#HY-13226 Ciforadenant MCE Cat#HY-101978 Corn Oil MCE Cat#HY-Y1888 DMSO SIGMA Cat#D8418 Recombinant Murine IL-2 PEPROTECH Cat#212-12 Recombinant Murine IL-4 PEPROTECH Cat#214-14 Recombinant Murine IL-10 PEPROTECH Cat#210-10 Recombinant Murine IL-12 p70 PEPROTECH Cat#210-12 Recombinant IL-13, Mouse MCE Cat#HY-P70460 Recombinant TGF beta 1/TGFB1, Mouse MCE Cat#HY-P7117 Bafilomycin A1 MCE Cat#HY-100558 Bortezomib MCE Cat#HY-10227 Recombinant Murine MCSF PEPROTECH Cat#315-02 D-Luciferin, Potassium Salt Goldbio Cat#LUCK-2G Critical commercial assays Zombie NIRTM Fixable Viability Kit Biolegend Cat#423106 Tumor Dissociation Kit, mouse MILTENYI Cat#130-096-730 EasySepTM Mouse CD4+ T Cell Isolation Kit STEMCELL Cat#19852 EasySepTM Mouse CD8+ T Cell Isolation Kit STEMCELL Cat#19853 RNeasy Mini Kit QIAGEN Cat# 74104 FOXP3/Transcription Factor Staining Buffer Set Thermo Fisher Cat# 00-5532-00 RNA isolater Total RNA Extraction Reagent Vazyme Cat# R401-01-AA PrimeScript RT Reagent Kit Takara Cat# RR047A TB Green Premix Ex Taq kit Takara Cat# RR420A Anti-Flag Nanobody IP kit (Magarose) AlpaLifeBio Cat# KTSM1361 mMESSAGE mMACHINETM T7 Transcription Kit Thermo Fisher Cat#AM1344 LipofectamineTM MessengerMAXTM Transfection Reagent Thermo Fisher Cat#LMRNA001 HiPerFect Transfection Reagent QIAGEN Cat#301704 QIAquick Gel Extraction Kit QIAGEN Cat#28704 Anti-Flag Nanobody IP kit (Magarose) AlpaLifeBio Cat#KTSM1361 PANO 7-plex IHC kit Panovue Cat#10217100100 Deposited data Processed Bulk RNA-seq data This paper https://doi.org/10.6084/m9.figshare.

    Article Title: Anchored screening identifies transcription factor blueprints underlying dendritic cell diversity and subset-specific anti-tumor immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pFUW-UbC-M2rtTA Rudolph Jaenisch, via Addgene RRID: Addgene_20342 psPAX2 Didier Trono, via Addgene RRID: Addgene_12260 pMD2.G Didier Trono, via Addgene RRID: Addgene_12259 pFUW-TetO-PU.1 Rosa et al.35 RRID: Addgene_139839 pFUW-TetO-AEBP2 This paper RRID: Addgene_207183 pFUW-TetO-ARID5B This paper RRID: Addgene_207184 pFUW-TetO-ASB2 This paper RRID: Addgene_207185 pFUW-TetO-BHLHE40 This paper RRID: Addgene_207186 pFUW-TetO-BCL6 Rosa et al.35 RRID: Addgene_139816 pFUW-TetO-E2F2 This paper RRID: Addgene_207187 pFUW-TetO-EGR2 This paper RRID: Addgene_207188 pFUW-TetO-HLX This paper RRID: Addgene_207189 pFUW-TetO-IRF2 Rosa et al.35 RRID: Addgene_139814 pFUW-TetO-IRF4 Rosa et al.35 RRID: Addgene_139804 pFUW-TetO-JUNB Rosa et al.36 RRID: Addgene_178441 pFUW-TetO-KCNIP3 This paper RRID: Addgene_207190 pFUW-TetO-KLF4 Rosa et al.35 RRID: Addgene_139828 pFUW-TetO-NFATC2 This paper RRID: Addgene_207191 pFUW-TetO-NFIX This paper RRID: Addgene_207192 pFUW-TetO-NFKB1 Rosa et al.35 RRID: Addgene_139822 pFUW-TetO-NOTCH2 This paper RRID: Addgene_207193 pFUW-TetO-NR4A1 This paper RRID: Addgene_207194 pFUW-TetO-POU2F2 This paper RRID: Addgene_207195 pFUW-TetO-PRDM1 This paper RRID: Addgene_207196 pFUW-TetO-RBPJ This paper RRID: Addgene_207197 pFUW-TetO-RELB Rosa et al.35 RRID: Addgene_139810 pFUW-TetO-RORC This paper RRID: Addgene_207198 pFUW-TetO-RUNX3 Rosa et al.35 RRID: Addgene_139812 pFUW-TetO-STAT3 Rosa et al.35 RRID: Addgene_139805 pFUW-TetO-STAT4 This paper RRID: Addgene_207199 pFUW-TetO-STAT5A Rosa et al.35 RRID: Addgene_139832 pFUW-TetO-TBX21 This paper RRID: Addgene_207233 pFUW-TetO-TCF7 This paper RRID: Addgene_207200 pFUW-TetO-TGIF1 This paper RRID: Addgene_207201 pFUW-TetO-TRPS1 This paper RRID: Addgene_207202 pFUW-TetO-ZBTB46 Rosa et al.35 RRID: Addgene_139811 pFUW-TetO-ZEB2 This paper RRID: Addgene_207203 pFUW-TetO-IRF8 Rosa et al.35 RRID: Addgene_139838 pFUW-TetO-ARID3A This paper RRID: Addgene_207204 pFUW-TetO-ARID5A This paper RRID: Addgene_207205 pFUW-TetO-BCL11A Rosa et al.35 RRID: Addgene_139809 pFUW-TetO-CBFA2T3 This paper RRID: Addgene_207206 pFUW-TetO-CREB3L2 This paper RRID: Addgene_207207 pFUW-TetO-ETS1 This paper RRID: Addgene_207208 pFUW-TetO-EYA1 This paper RRID: Addgene_207209 pFUW-TetO-FOXP1 This paper RRID: Addgene_207210 pFUW-TetO-HDAC5 This paper RRID: Addgene_207211 pFUW-TetO-HHEX This paper RRID: Addgene_207212 (Continued on next page) ll OPEN ACCESSArticle Immunity 58, 1–20.e1–e13, October 14, 2025 e5

    Single Cell:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Formalin-fixed Paraffin-Embedded:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Gene Expression:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Blocking Assay:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Amplification:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Polymer:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Labeling:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    RNA Sequencing:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Spatial Transcriptomics:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Sequencing:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Modification:

    Article Title: Innate lymphoid cells integrate sensing and plasticity to control fungal infections
    Article Snippet: Cat# 65-0840-90 Cyanine5 Streptavidin Biolegend Cat#405209 APC-Fire750 Streptavidin Biolegend Cat#405250 Streptavidin-DyLight 488 (currently marketed as Alexa Fluor 488) Jackson ImmunoResearch Cat#016-540-084 7-AAD Viability Staining Solution Biolegend Cat#420403 Apotracker Green Biolegend Cat#427401 Zombie Aqua Fixable Viability Kit Biolegend Cat#423102 Zombie NIR Fixable Viability Kit Biolegend Cat#423105 Zombie Violet Fixable Viability Kit Biolegend Cat#423113 Collagenase II Gibco; Fisher Scientific Cat# 17101015 DNAse I Sigma-Aldrich Cat#10104159001 Percoll GE-Healthcare Cat#GE17-0891-01 Recombinant Mouse IL-2 Biolegend Cat#575404 Recombinant Mouse IL-7 Biolegend Cat#577802 Recombinant Mouse SCF Miltenyi Cat#130-101-693 Recombinant Mouse IL-1β MedchemExpress Cat# MCE-HY-P7073A-2μg Recombinant Mouse IL-23 Biolegend Cat#589002 Recombinant Mouse IL-17C BioTechne Cat#2306-ML-025 Recombinant Rat/Mouse TGFβ1 MedchemExpress MCE-HY-P7117-2μg Brefeldin A Biolegend Cat#420601 Phorbol myristate acetate (PMA) Sigma-Aldrich Cat#P1585 Ionomycin Sigma-Aldrich Cat#IO634 Dimethyl sulfoxide (DMSO) Sigma-Aldrich Cat#D2438 Zymosan Sigma-Aldrich Cat#Z4250 Curdlan Invivogen Cat#tlrl-cura Laminarin Invivogen Cat#tlrl-lam Chitin Wagener et al.115 N/A Dynasore hydrate Sigma-Aldrich Cat#D7693 R406 (Syk Inhibitor) Selleckchem Cat#S2194 α-D-Mannan Sigma-Aldrich Cat#M7504 Ketamin: Ketasol Livisto GTIN# 04050478000336 Xylazine: Sedaxylan Dechra GTIN# 08714225157464 Intracellular Staining Permeabilization Wash Buffer (10X) Biolegend Cat#421002 Fixation Buffer Biolegend Cat#420801 (Continued on next page) 22 Cell Reports 45, 117140, April 28, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Red Blood Cell Lysis Buffer (10X) Biolegend Cat#420302 True-Phos Perm Buffer Biolegend Cat#425401 Dulbecco’s Phosphate Buffered Saline Sigma-Aldrich Cat#8537 Hanks’ Balanced Salt solution Sigma-Aldrich Cat#8264 IMDM (Iscove’s Modified Dulbecco’s Medium) Lonza Cat#12-722F RPMI 1640 Medium Gibco; Fisher Scientific Cat#21875091 GlutaMAX Supplement Gibco; Fisher Scientific Cat#35050061 HEPES (1M) Gibco; Fisher Scientific Cat#15630080 Sodium pyruvate solution,100 mM Sigma-Aldrich Cat#S8636 MEM Non-essential Amino Acid Solution (100X) Sigma-Aldrich Cat#M7145 RNAlater Sigma-Aldrich Cat#R0901 z-IETD-FMK MedchemExpress Cat#MCE-HY-101297-1mg Necrostatin-1 MedchemExpress Cat#HY-15760 Ultra PureTM Distilled DNAse/RNAse free Water Invitrogen; Fisher Scientific Cat#10977049 Commercial assays Lineage cell depletion kit, mouse Miltenyi Cat130-090-858 Foxp3/Transcription Factor Staining Buffer Set-1 kit eBioscience, Fisher Scient. .. Cat#00-5523-00 System for Reverse Transcription Using AMV RT Promega Cat#A3500 SsoAdvanced Universal SYBR Green Supermix Biorad Cat#1725271 QIAGEN RNeasy Plus Micro Kit Quiagen Cat#74034 Monarch Spin RNA Cleanup Kit (10 μg) New England Biolabs Cat#T2030L Deposited data Mass Spectrometry of culture supernatants (ILC-Cgl interaction) ProteomeXchange Consortium111 PRIDE:PXD061271 Pulmonary ILC Sequencing (Smart-Seq2) GEO-database GEO:GSE293220 RNA-Sequencing of infected lung tissues after ILC-transfer GEO-database GEO:GSE293054 Experimental models cell lines Feeder cells: OP9-DL1 Gift of Meinrad Busslinger Schmitt & Zúñiga-Pflücker116 Experimental murine models, strains Mouse: C57BL/6J mice Jackson Laboratory Cat#000664; RRID: IMSR_JAX:000664 Mouse: Rag1− /− : B6.129S7-Rag1tm1Mom/J Jackson Laboratory RRID:IMSR_JAX:002096 Mouse: Rag2− /− Il2rg− /− Cao et al.117 Veronika Sexl Mouse: IL17A-IRES-GFP-KI reporter: C57BL/6-Il17atm1Bcgen/J Jackson Laboratory RRID: IMSR_JAX:018472 Mouse: Tec− /− Rag1− /− IL-17AeGFP: C57BL/6Il17atm1Bcgen/J x Tectm1Welm x B6.129S7-Rag1tm1Mom/J This study N/A Mouse: Dectin-1− /− : B6.129S6-Clec7atm1Gdb/J Taylor et al.118 RRID:IMSR_JAX:012337 Mouse: Dectin-2− /− : Clec4ntm1Yiw Saijo et al.119 MGI:4459637 Mouse: Tlr2/− : Tlr2tm1Aki Takeuchi et al.120 MGI:2178675 Mouse: Tlr4− /− : Tlr4tm1Aki Hashino et al.121 MGI:1860885 Mouse: Tec− /− : Tectm1Welm Ellmeier et al.34 MGI:2450883 Oligonucleotides m-Eef1a forward/reverse (5′-3′): ACGAGGCAATGTTG CTGGTGAC/GTGTGACAATCCAGAACAGGAGC Origene Cat#MP204369; GenBank:NM_010106 m-Tgfb1 forward/reverse (5′-3′): TGACGTCACTGGA GTTGTACGG/GGTTCATGTCATGGATGGTGC N/A GenBank:NM_011577.2 m-Il1b forward/reverse (5′-3′): (CCAACAAGTGATAT TCTCCATGAG/TCTTTCATTACACAGGACAGGT) N/A GenBank:NM_008361.4 (Continued on next page) Cell Reports 45, 117140, April 28, 2026 23



    Similar Products

    98
    Miltenyi Biotec mouse miltenyi biotec
    Mouse Miltenyi Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/Tumor+Dissociation+Kit%2C+mouse/pm42531132-267-152-153
    Average 98 stars, based on 1 article reviews
    mouse miltenyi biotec - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    95
    Miltenyi Biotec liver perfusion kit miltenyi
    Liver Perfusion Kit Miltenyi, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/Liver+Perfusion+Kit%2C+mouse+and+rat/pm42526445-263-184-187
    Average 95 stars, based on 1 article reviews
    liver perfusion kit miltenyi - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Miltenyi Biotec magnetic microbeads miltenyi biotec
    Magnetic Microbeads Miltenyi Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/CD31+MicroBeads%2C+mouse/pm42501329-276-41-43
    Average 96 stars, based on 1 article reviews
    magnetic microbeads miltenyi biotec - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Miltenyi Biotec o4 miltenyi 130 096 670
    O4 Miltenyi 130 096 670, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/Anti-O4+MicroBeads%2C+human%2C+mouse/pm42493478-343-12-13
    Average 95 stars, based on 1 article reviews
    o4 miltenyi 130 096 670 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    97
    Miltenyi Biotec rr820a pan t cell isolation kit ii miltenyi biotec
    Rr820a Pan T Cell Isolation Kit Ii Miltenyi Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/Pan+T+Cell+Isolation+Kit+II%2C+mouse/pm42486097-244-26-33
    Average 97 stars, based on 1 article reviews
    rr820a pan t cell isolation kit ii miltenyi biotec - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    Miltenyi Biotec dr khoor mayo clinic jacksonville critical commercial assays lung dissociation kit miltenyi biotec
    Dr Khoor Mayo Clinic Jacksonville Critical Commercial Assays Lung Dissociation Kit Miltenyi Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/Lung+Dissociation+Kit%2C+mouse/pm42470637-183-251-262
    Average 96 stars, based on 1 article reviews
    dr khoor mayo clinic jacksonville critical commercial assays lung dissociation kit miltenyi biotec - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Miltenyi Biotec mouse miltenyi
    Mouse Miltenyi, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/CD45+(TIL)+MicroBeads%2C+mouse/pm42468528-262-33-34
    Average 96 stars, based on 1 article reviews
    mouse miltenyi - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Miltenyi Biotec miltenyi biotec anti cd49b
    Miltenyi Biotec Anti Cd49b, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/CD49b+(DX5)+MicroBeads%2C+mouse/pmc13414219-64-8-8
    Average 93 stars, based on 1 article reviews
    miltenyi biotec anti cd49b - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    95
    Miltenyi Biotec iv) pe anti-mouse igm (rat igg2a; miltenyi 130-095-908
    Iv) Pe Anti Mouse Igm (Rat Igg2a; Miltenyi 130 095 908, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/IgM+Antibody%2C+anti-mouse/pm42455073-74-69-75
    Average 95 stars, based on 1 article reviews
    iv) pe anti-mouse igm (rat igg2a; miltenyi 130-095-908 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    97
    Miltenyi Biotec mouse macsplex ev kit 130 122 211 miltenyi biotec germany
    Mouse Macsplex Ev Kit 130 122 211 Miltenyi Biotec Germany, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+miltenyi/MACSPlex+EV+Kit+IO%2C+mouse/pmc13360959-87-25-30
    Average 97 stars, based on 1 article reviews
    mouse macsplex ev kit 130 122 211 miltenyi biotec germany - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    Image Search Results